In Science and Biology lessons, our girls have shown that they are thriving in guided home learning.

As part of their electric circuit lesson, Year 7 inventively used MS Teams to pass on their happy energy through the circuit they created.

After learning about the Theory of Evolution by Natural Selection, the friendship between Charles Darwin and Alfred Wallace, Year 8S students learned about Extinction Level Events and Fossils.

They researched fossils, preserved remains from a past geological age, and they drew/painted one they found most interesting.

Year 10X started their Biology topic Inheritance after Christmas. They made some DNA models at home to revise their knowledge of the DNA structure, and they decoded a very short sequence of bases (GATAACGCAATTAGTGGGCGCGAGGCTACC). Try it at home using the decoder.